ID: 1202704692

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270713v1_random:14073-14095
Sequence CAGGCTCAGGCCTCTGTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202704686_1202704692 -10 Left 1202704686 1_KI270713v1_random:14060-14082 CCTCCTGGGAAGGCAGGCTCAGG No data
Right 1202704692 1_KI270713v1_random:14073-14095 CAGGCTCAGGCCTCTGTAGGGGG No data
1202704674_1202704692 27 Left 1202704674 1_KI270713v1_random:14023-14045 CCAGCTGCAGGGAAGGGCCCTGG No data
Right 1202704692 1_KI270713v1_random:14073-14095 CAGGCTCAGGCCTCTGTAGGGGG No data
1202704684_1202704692 -4 Left 1202704684 1_KI270713v1_random:14054-14076 CCTGGGCCTCCTGGGAAGGCAGG No data
Right 1202704692 1_KI270713v1_random:14073-14095 CAGGCTCAGGCCTCTGTAGGGGG No data
1202704680_1202704692 9 Left 1202704680 1_KI270713v1_random:14041-14063 CCTGGGTGAGAGTCCTGGGCCTC No data
Right 1202704692 1_KI270713v1_random:14073-14095 CAGGCTCAGGCCTCTGTAGGGGG No data
1202704679_1202704692 10 Left 1202704679 1_KI270713v1_random:14040-14062 CCCTGGGTGAGAGTCCTGGGCCT No data
Right 1202704692 1_KI270713v1_random:14073-14095 CAGGCTCAGGCCTCTGTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202704692 Original CRISPR CAGGCTCAGGCCTCTGTAGG GGG Intergenic
No off target data available for this crispr