ID: 1202704853

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270713v1_random:15114-15136
Sequence CAGCTGTCCCTCCACCAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202704853_1202704866 30 Left 1202704853 1_KI270713v1_random:15114-15136 CCCGGCTGGTGGAGGGACAGCTG No data
Right 1202704866 1_KI270713v1_random:15167-15189 CCCCCGGCCCGCGACAACCCGGG No data
1202704853_1202704857 -5 Left 1202704853 1_KI270713v1_random:15114-15136 CCCGGCTGGTGGAGGGACAGCTG No data
Right 1202704857 1_KI270713v1_random:15132-15154 AGCTGCGTCCGGGCAGACCCCGG No data
1202704853_1202704864 29 Left 1202704853 1_KI270713v1_random:15114-15136 CCCGGCTGGTGGAGGGACAGCTG No data
Right 1202704864 1_KI270713v1_random:15166-15188 GCCCCCGGCCCGCGACAACCCGG No data
1202704853_1202704862 14 Left 1202704853 1_KI270713v1_random:15114-15136 CCCGGCTGGTGGAGGGACAGCTG No data
Right 1202704862 1_KI270713v1_random:15151-15173 CCGGCCTCTTGTCGTGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202704853 Original CRISPR CAGCTGTCCCTCCACCAGCC GGG (reversed) Intergenic
No off target data available for this crispr