ID: 1202704896

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270713v1_random:15253-15275
Sequence CACCCACCGCTGCCCGGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202704896_1202704905 20 Left 1202704896 1_KI270713v1_random:15253-15275 CCGGTGCCGGGCAGCGGTGGGTG No data
Right 1202704905 1_KI270713v1_random:15296-15318 GCGCCCCCAGCCCTGGGACGTGG No data
1202704896_1202704901 13 Left 1202704896 1_KI270713v1_random:15253-15275 CCGGTGCCGGGCAGCGGTGGGTG No data
Right 1202704901 1_KI270713v1_random:15289-15311 GCCCACAGCGCCCCCAGCCCTGG No data
1202704896_1202704903 14 Left 1202704896 1_KI270713v1_random:15253-15275 CCGGTGCCGGGCAGCGGTGGGTG No data
Right 1202704903 1_KI270713v1_random:15290-15312 CCCACAGCGCCCCCAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202704896 Original CRISPR CACCCACCGCTGCCCGGCAC CGG (reversed) Intergenic
No off target data available for this crispr