ID: 1202704903 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1_KI270713v1_random:15290-15312 |
| Sequence | CCCACAGCGCCCCCAGCCCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1202704898_1202704903 | 8 | Left | 1202704898 | 1_KI270713v1_random:15259-15281 | CCGGGCAGCGGTGGGTGCGGCAC | No data | ||
| Right | 1202704903 | 1_KI270713v1_random:15290-15312 | CCCACAGCGCCCCCAGCCCTGGG | No data | ||||
| 1202704896_1202704903 | 14 | Left | 1202704896 | 1_KI270713v1_random:15253-15275 | CCGGTGCCGGGCAGCGGTGGGTG | No data | ||
| Right | 1202704903 | 1_KI270713v1_random:15290-15312 | CCCACAGCGCCCCCAGCCCTGGG | No data | ||||
| 1202704893_1202704903 | 17 | Left | 1202704893 | 1_KI270713v1_random:15250-15272 | CCTCCGGTGCCGGGCAGCGGTGG | No data | ||
| Right | 1202704903 | 1_KI270713v1_random:15290-15312 | CCCACAGCGCCCCCAGCCCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1202704903 | Original CRISPR | CCCACAGCGCCCCCAGCCCT GGG | Intergenic | ||
| No off target data available for this crispr | |||||