ID: 1202704903

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270713v1_random:15290-15312
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202704898_1202704903 8 Left 1202704898 1_KI270713v1_random:15259-15281 CCGGGCAGCGGTGGGTGCGGCAC No data
Right 1202704903 1_KI270713v1_random:15290-15312 CCCACAGCGCCCCCAGCCCTGGG No data
1202704896_1202704903 14 Left 1202704896 1_KI270713v1_random:15253-15275 CCGGTGCCGGGCAGCGGTGGGTG No data
Right 1202704903 1_KI270713v1_random:15290-15312 CCCACAGCGCCCCCAGCCCTGGG No data
1202704893_1202704903 17 Left 1202704893 1_KI270713v1_random:15250-15272 CCTCCGGTGCCGGGCAGCGGTGG No data
Right 1202704903 1_KI270713v1_random:15290-15312 CCCACAGCGCCCCCAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202704903 Original CRISPR CCCACAGCGCCCCCAGCCCT GGG Intergenic
No off target data available for this crispr