ID: 1202704905

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270713v1_random:15296-15318
Sequence GCGCCCCCAGCCCTGGGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202704893_1202704905 23 Left 1202704893 1_KI270713v1_random:15250-15272 CCTCCGGTGCCGGGCAGCGGTGG No data
Right 1202704905 1_KI270713v1_random:15296-15318 GCGCCCCCAGCCCTGGGACGTGG No data
1202704896_1202704905 20 Left 1202704896 1_KI270713v1_random:15253-15275 CCGGTGCCGGGCAGCGGTGGGTG No data
Right 1202704905 1_KI270713v1_random:15296-15318 GCGCCCCCAGCCCTGGGACGTGG No data
1202704900_1202704905 -9 Left 1202704900 1_KI270713v1_random:15282-15304 CCACAGTGCCCACAGCGCCCCCA No data
Right 1202704905 1_KI270713v1_random:15296-15318 GCGCCCCCAGCCCTGGGACGTGG No data
1202704898_1202704905 14 Left 1202704898 1_KI270713v1_random:15259-15281 CCGGGCAGCGGTGGGTGCGGCAC No data
Right 1202704905 1_KI270713v1_random:15296-15318 GCGCCCCCAGCCCTGGGACGTGG No data
1202704899_1202704905 -8 Left 1202704899 1_KI270713v1_random:15281-15303 CCCACAGTGCCCACAGCGCCCCC No data
Right 1202704905 1_KI270713v1_random:15296-15318 GCGCCCCCAGCCCTGGGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202704905 Original CRISPR GCGCCCCCAGCCCTGGGACG TGG Intergenic
No off target data available for this crispr