ID: 1202709440

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270714v1_random:9389-9411
Sequence CTAACGGCATGGAATGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202709433_1202709440 29 Left 1202709433 1_KI270714v1_random:9337-9359 CCAGCATTTACTTTTGTCTGGAG No data
Right 1202709440 1_KI270714v1_random:9389-9411 CTAACGGCATGGAATGATGAAGG No data
1202709436_1202709440 -1 Left 1202709436 1_KI270714v1_random:9367-9389 CCATGCATGGTCCTATAAATGTC No data
Right 1202709440 1_KI270714v1_random:9389-9411 CTAACGGCATGGAATGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202709440 Original CRISPR CTAACGGCATGGAATGATGA AGG Intergenic
No off target data available for this crispr