ID: 1202709440 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1_KI270714v1_random:9389-9411 |
Sequence | CTAACGGCATGGAATGATGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1202709433_1202709440 | 29 | Left | 1202709433 | 1_KI270714v1_random:9337-9359 | CCAGCATTTACTTTTGTCTGGAG | No data | ||
Right | 1202709440 | 1_KI270714v1_random:9389-9411 | CTAACGGCATGGAATGATGAAGG | No data | ||||
1202709436_1202709440 | -1 | Left | 1202709436 | 1_KI270714v1_random:9367-9389 | CCATGCATGGTCCTATAAATGTC | No data | ||
Right | 1202709440 | 1_KI270714v1_random:9389-9411 | CTAACGGCATGGAATGATGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1202709440 | Original CRISPR | CTAACGGCATGGAATGATGA AGG | Intergenic | ||
No off target data available for this crispr |