ID: 1202712371

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270714v1_random:25438-25460
Sequence CCCCGCAGGCGGAACTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202712371_1202712389 22 Left 1202712371 1_KI270714v1_random:25438-25460 CCCAGGGAGTTCCGCCTGCGGGG No data
Right 1202712389 1_KI270714v1_random:25483-25505 CAGCTTAGGGAGAGGCTGAGGGG No data
1202712371_1202712388 21 Left 1202712371 1_KI270714v1_random:25438-25460 CCCAGGGAGTTCCGCCTGCGGGG No data
Right 1202712388 1_KI270714v1_random:25482-25504 CCAGCTTAGGGAGAGGCTGAGGG No data
1202712371_1202712391 28 Left 1202712371 1_KI270714v1_random:25438-25460 CCCAGGGAGTTCCGCCTGCGGGG No data
Right 1202712391 1_KI270714v1_random:25489-25511 AGGGAGAGGCTGAGGGGTCTGGG No data
1202712371_1202712390 27 Left 1202712371 1_KI270714v1_random:25438-25460 CCCAGGGAGTTCCGCCTGCGGGG No data
Right 1202712390 1_KI270714v1_random:25488-25510 TAGGGAGAGGCTGAGGGGTCTGG No data
1202712371_1202712381 8 Left 1202712371 1_KI270714v1_random:25438-25460 CCCAGGGAGTTCCGCCTGCGGGG No data
Right 1202712381 1_KI270714v1_random:25469-25491 GGGGGCTCACCTCCCAGCTTAGG No data
1202712371_1202712386 20 Left 1202712371 1_KI270714v1_random:25438-25460 CCCAGGGAGTTCCGCCTGCGGGG No data
Right 1202712386 1_KI270714v1_random:25481-25503 CCCAGCTTAGGGAGAGGCTGAGG No data
1202712371_1202712383 14 Left 1202712371 1_KI270714v1_random:25438-25460 CCCAGGGAGTTCCGCCTGCGGGG No data
Right 1202712383 1_KI270714v1_random:25475-25497 TCACCTCCCAGCTTAGGGAGAGG No data
1202712371_1202712379 -10 Left 1202712371 1_KI270714v1_random:25438-25460 CCCAGGGAGTTCCGCCTGCGGGG No data
Right 1202712379 1_KI270714v1_random:25451-25473 GCCTGCGGGGATGAAGGTGGGGG No data
1202712371_1202712382 9 Left 1202712371 1_KI270714v1_random:25438-25460 CCCAGGGAGTTCCGCCTGCGGGG No data
Right 1202712382 1_KI270714v1_random:25470-25492 GGGGCTCACCTCCCAGCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202712371 Original CRISPR CCCCGCAGGCGGAACTCCCT GGG (reversed) Intergenic
No off target data available for this crispr