ID: 1202712829

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270714v1_random:27042-27064
Sequence TGCAGGAAACGCGACACCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202712817_1202712829 23 Left 1202712817 1_KI270714v1_random:26996-27018 CCTGCGGTGGCCTCAGACCCTTC No data
Right 1202712829 1_KI270714v1_random:27042-27064 TGCAGGAAACGCGACACCGCAGG No data
1202712827_1202712829 -7 Left 1202712827 1_KI270714v1_random:27026-27048 CCGACCTGGCTCACGTTGCAGGA No data
Right 1202712829 1_KI270714v1_random:27042-27064 TGCAGGAAACGCGACACCGCAGG No data
1202712818_1202712829 13 Left 1202712818 1_KI270714v1_random:27006-27028 CCTCAGACCCTTCACCCCGCCCG No data
Right 1202712829 1_KI270714v1_random:27042-27064 TGCAGGAAACGCGACACCGCAGG No data
1202712824_1202712829 -3 Left 1202712824 1_KI270714v1_random:27022-27044 CCGCCCGACCTGGCTCACGTTGC No data
Right 1202712829 1_KI270714v1_random:27042-27064 TGCAGGAAACGCGACACCGCAGG No data
1202712816_1202712829 24 Left 1202712816 1_KI270714v1_random:26995-27017 CCCTGCGGTGGCCTCAGACCCTT No data
Right 1202712829 1_KI270714v1_random:27042-27064 TGCAGGAAACGCGACACCGCAGG No data
1202712822_1202712829 -1 Left 1202712822 1_KI270714v1_random:27020-27042 CCCCGCCCGACCTGGCTCACGTT No data
Right 1202712829 1_KI270714v1_random:27042-27064 TGCAGGAAACGCGACACCGCAGG No data
1202712825_1202712829 -6 Left 1202712825 1_KI270714v1_random:27025-27047 CCCGACCTGGCTCACGTTGCAGG No data
Right 1202712829 1_KI270714v1_random:27042-27064 TGCAGGAAACGCGACACCGCAGG No data
1202712820_1202712829 6 Left 1202712820 1_KI270714v1_random:27013-27035 CCCTTCACCCCGCCCGACCTGGC No data
Right 1202712829 1_KI270714v1_random:27042-27064 TGCAGGAAACGCGACACCGCAGG No data
1202712823_1202712829 -2 Left 1202712823 1_KI270714v1_random:27021-27043 CCCGCCCGACCTGGCTCACGTTG No data
Right 1202712829 1_KI270714v1_random:27042-27064 TGCAGGAAACGCGACACCGCAGG No data
1202712821_1202712829 5 Left 1202712821 1_KI270714v1_random:27014-27036 CCTTCACCCCGCCCGACCTGGCT No data
Right 1202712829 1_KI270714v1_random:27042-27064 TGCAGGAAACGCGACACCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202712829 Original CRISPR TGCAGGAAACGCGACACCGC AGG Intergenic
No off target data available for this crispr