ID: 1202713458

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270714v1_random:29824-29846
Sequence GAGTGTGCCCAGGAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202713458_1202713473 27 Left 1202713458 1_KI270714v1_random:29824-29846 CCCTCTTCCTCCTGGGCACACTC No data
Right 1202713473 1_KI270714v1_random:29874-29896 GCTGGAGTGGCTGGAGGAGCAGG No data
1202713458_1202713467 9 Left 1202713458 1_KI270714v1_random:29824-29846 CCCTCTTCCTCCTGGGCACACTC No data
Right 1202713467 1_KI270714v1_random:29856-29878 AGGGTGCTGGCCCTTGATGCTGG No data
1202713458_1202713472 21 Left 1202713458 1_KI270714v1_random:29824-29846 CCCTCTTCCTCCTGGGCACACTC No data
Right 1202713472 1_KI270714v1_random:29868-29890 CTTGATGCTGGAGTGGCTGGAGG No data
1202713458_1202713464 -10 Left 1202713458 1_KI270714v1_random:29824-29846 CCCTCTTCCTCCTGGGCACACTC No data
Right 1202713464 1_KI270714v1_random:29837-29859 GGGCACACTCACCACGTGGAGGG No data
1202713458_1202713468 14 Left 1202713458 1_KI270714v1_random:29824-29846 CCCTCTTCCTCCTGGGCACACTC No data
Right 1202713468 1_KI270714v1_random:29861-29883 GCTGGCCCTTGATGCTGGAGTGG No data
1202713458_1202713469 18 Left 1202713458 1_KI270714v1_random:29824-29846 CCCTCTTCCTCCTGGGCACACTC No data
Right 1202713469 1_KI270714v1_random:29865-29887 GCCCTTGATGCTGGAGTGGCTGG No data
1202713458_1202713465 -4 Left 1202713458 1_KI270714v1_random:29824-29846 CCCTCTTCCTCCTGGGCACACTC No data
Right 1202713465 1_KI270714v1_random:29843-29865 ACTCACCACGTGGAGGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202713458 Original CRISPR GAGTGTGCCCAGGAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr