ID: 1202715712

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270714v1_random:41321-41343
Sequence CACGCTGCTGGGGCATCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202715712_1202715717 -4 Left 1202715712 1_KI270714v1_random:41321-41343 CCCTGGGATGCCCCAGCAGCGTG No data
Right 1202715717 1_KI270714v1_random:41340-41362 CGTGCTGCTTACAGAGCCCCAGG No data
1202715712_1202715724 26 Left 1202715712 1_KI270714v1_random:41321-41343 CCCTGGGATGCCCCAGCAGCGTG No data
Right 1202715724 1_KI270714v1_random:41370-41392 GCTCAGCTCTCCCCCTTAGAAGG No data
1202715712_1202715719 4 Left 1202715712 1_KI270714v1_random:41321-41343 CCCTGGGATGCCCCAGCAGCGTG No data
Right 1202715719 1_KI270714v1_random:41348-41370 TTACAGAGCCCCAGGGTCCAAGG No data
1202715712_1202715725 27 Left 1202715712 1_KI270714v1_random:41321-41343 CCCTGGGATGCCCCAGCAGCGTG No data
Right 1202715725 1_KI270714v1_random:41371-41393 CTCAGCTCTCCCCCTTAGAAGGG No data
1202715712_1202715718 -3 Left 1202715712 1_KI270714v1_random:41321-41343 CCCTGGGATGCCCCAGCAGCGTG No data
Right 1202715718 1_KI270714v1_random:41341-41363 GTGCTGCTTACAGAGCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202715712 Original CRISPR CACGCTGCTGGGGCATCCCA GGG (reversed) Intergenic
No off target data available for this crispr