ID: 1202721794

View in Genome Browser
Species Human (GRCh38)
Location 2_KI270715v1_random:92555-92577
Sequence AATATCTGCAAGAGTATATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202721793_1202721794 17 Left 1202721793 2_KI270715v1_random:92515-92537 CCTTTCTTTTGATAGAGCAGTTT No data
Right 1202721794 2_KI270715v1_random:92555-92577 AATATCTGCAAGAGTATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202721794 Original CRISPR AATATCTGCAAGAGTATATT TGG Intergenic
No off target data available for this crispr