ID: 1202727019

View in Genome Browser
Species Human (GRCh38)
Location 2_KI270716v1_random:11194-11216
Sequence CCAACGGATATTTGCATAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202727015_1202727019 19 Left 1202727015 2_KI270716v1_random:11152-11174 CCATTTGATGATGACTTGGTTTG No data
Right 1202727019 2_KI270716v1_random:11194-11216 CCAACGGATATTTGCATAGTTGG No data
1202727013_1202727019 29 Left 1202727013 2_KI270716v1_random:11142-11164 CCATTCGATTCCATTTGATGATG No data
Right 1202727019 2_KI270716v1_random:11194-11216 CCAACGGATATTTGCATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202727019 Original CRISPR CCAACGGATATTTGCATAGT TGG Intergenic
No off target data available for this crispr