ID: 1202766976

View in Genome Browser
Species Human (GRCh38)
Location 4_GL000008v2_random:155885-155907
Sequence GGGGCATACACAATATATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202766976_1202766982 17 Left 1202766976 4_GL000008v2_random:155885-155907 CCGTGATATATTGTGTATGCCCC No data
Right 1202766982 4_GL000008v2_random:155925-155947 TGTTTATGTTCCAACAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202766976 Original CRISPR GGGGCATACACAATATATCA CGG (reversed) Intergenic
No off target data available for this crispr