ID: 1202778366

View in Genome Browser
Species Human (GRCh38)
Location 9_KI270717v1_random:12830-12852
Sequence CCCCATGAGGTCATCAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202778359_1202778366 11 Left 1202778359 9_KI270717v1_random:12796-12818 CCTCCCTTCCTGTGTCAACTGCT No data
Right 1202778366 9_KI270717v1_random:12830-12852 CCCCATGAGGTCATCAGTGCAGG No data
1202778356_1202778366 23 Left 1202778356 9_KI270717v1_random:12784-12806 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 1202778366 9_KI270717v1_random:12830-12852 CCCCATGAGGTCATCAGTGCAGG No data
1202778358_1202778366 17 Left 1202778358 9_KI270717v1_random:12790-12812 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 1202778366 9_KI270717v1_random:12830-12852 CCCCATGAGGTCATCAGTGCAGG No data
1202778360_1202778366 8 Left 1202778360 9_KI270717v1_random:12799-12821 CCCTTCCTGTGTCAACTGCTCAA No data
Right 1202778366 9_KI270717v1_random:12830-12852 CCCCATGAGGTCATCAGTGCAGG No data
1202778363_1202778366 3 Left 1202778363 9_KI270717v1_random:12804-12826 CCTGTGTCAACTGCTCAAAGGCA No data
Right 1202778366 9_KI270717v1_random:12830-12852 CCCCATGAGGTCATCAGTGCAGG No data
1202778361_1202778366 7 Left 1202778361 9_KI270717v1_random:12800-12822 CCTTCCTGTGTCAACTGCTCAAA No data
Right 1202778366 9_KI270717v1_random:12830-12852 CCCCATGAGGTCATCAGTGCAGG No data
1202778357_1202778366 18 Left 1202778357 9_KI270717v1_random:12789-12811 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 1202778366 9_KI270717v1_random:12830-12852 CCCCATGAGGTCATCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202778366 Original CRISPR CCCCATGAGGTCATCAGTGC AGG Intergenic
No off target data available for this crispr