ID: 1202778407

View in Genome Browser
Species Human (GRCh38)
Location 9_KI270717v1_random:13146-13168
Sequence AGTTAACTGGAGAAGATGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202778404_1202778407 14 Left 1202778404 9_KI270717v1_random:13109-13131 CCAGTATAGGACAAGAGCTGTCT No data
Right 1202778407 9_KI270717v1_random:13146-13168 AGTTAACTGGAGAAGATGACCGG No data
1202778403_1202778407 15 Left 1202778403 9_KI270717v1_random:13108-13130 CCCAGTATAGGACAAGAGCTGTC No data
Right 1202778407 9_KI270717v1_random:13146-13168 AGTTAACTGGAGAAGATGACCGG No data
1202778402_1202778407 24 Left 1202778402 9_KI270717v1_random:13099-13121 CCACAAAAGCCCAGTATAGGACA No data
Right 1202778407 9_KI270717v1_random:13146-13168 AGTTAACTGGAGAAGATGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202778407 Original CRISPR AGTTAACTGGAGAAGATGAC CGG Intergenic
No off target data available for this crispr