ID: 1202780529

View in Genome Browser
Species Human (GRCh38)
Location 9_KI270717v1_random:31667-31689
Sequence GCCTTGTAATACGCCCGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202780526_1202780529 -1 Left 1202780526 9_KI270717v1_random:31645-31667 CCAGGATGGTCTCGATCTCCTGG 0: 389
1: 53730
2: 75466
3: 152867
4: 231362
Right 1202780529 9_KI270717v1_random:31667-31689 GCCTTGTAATACGCCCGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202780529 Original CRISPR GCCTTGTAATACGCCCGCCT TGG Intergenic
No off target data available for this crispr