ID: 1202784009

View in Genome Browser
Species Human (GRCh38)
Location 9_KI270718v1_random:30103-30125
Sequence ACATGGCATCTGTACAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202784004_1202784009 26 Left 1202784004 9_KI270718v1_random:30054-30076 CCTATCTAGTTCTAGCCTTTAAA No data
Right 1202784009 9_KI270718v1_random:30103-30125 ACATGGCATCTGTACAAGCTAGG No data
1202784008_1202784009 -9 Left 1202784008 9_KI270718v1_random:30089-30111 CCAAATCTAGAGTTACATGGCAT No data
Right 1202784009 9_KI270718v1_random:30103-30125 ACATGGCATCTGTACAAGCTAGG No data
1202784006_1202784009 1 Left 1202784006 9_KI270718v1_random:30079-30101 CCTTCTGTCACCAAATCTAGAGT No data
Right 1202784009 9_KI270718v1_random:30103-30125 ACATGGCATCTGTACAAGCTAGG No data
1202784005_1202784009 11 Left 1202784005 9_KI270718v1_random:30069-30091 CCTTTAAATTCCTTCTGTCACCA No data
Right 1202784009 9_KI270718v1_random:30103-30125 ACATGGCATCTGTACAAGCTAGG No data
1202784003_1202784009 27 Left 1202784003 9_KI270718v1_random:30053-30075 CCCTATCTAGTTCTAGCCTTTAA No data
Right 1202784009 9_KI270718v1_random:30103-30125 ACATGGCATCTGTACAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202784009 Original CRISPR ACATGGCATCTGTACAAGCT AGG Intergenic
No off target data available for this crispr