ID: 1202785095

View in Genome Browser
Species Human (GRCh38)
Location 9_KI270719v1_random:6146-6168
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202785092_1202785095 10 Left 1202785092 9_KI270719v1_random:6113-6135 CCATCTTCATAAATTAAAAAAGA No data
Right 1202785095 9_KI270719v1_random:6146-6168 CTAGCGAAGTGGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202785095 Original CRISPR CTAGCGAAGTGGAATGAGGA AGG Intergenic
No off target data available for this crispr