ID: 1202785351

View in Genome Browser
Species Human (GRCh38)
Location 9_KI270719v1_random:10397-10419
Sequence CTGTTGTTGTTAAGAAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202785351_1202785354 26 Left 1202785351 9_KI270719v1_random:10397-10419 CCTTATTTTCTTAACAACAACAG No data
Right 1202785354 9_KI270719v1_random:10446-10468 TGCCGCATGCACCTAGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202785351 Original CRISPR CTGTTGTTGTTAAGAAAATA AGG (reversed) Intergenic
No off target data available for this crispr