ID: 1202789397

View in Genome Browser
Species Human (GRCh38)
Location 9_KI270719v1_random:71097-71119
Sequence CAGGCACATGGTGTTGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202789389_1202789397 24 Left 1202789389 9_KI270719v1_random:71050-71072 CCTTCTGGCTGCTTTTGTGGGCT No data
Right 1202789397 9_KI270719v1_random:71097-71119 CAGGCACATGGTGTTGTTGGTGG No data
1202789386_1202789397 28 Left 1202789386 9_KI270719v1_random:71046-71068 CCTGCCTTCTGGCTGCTTTTGTG No data
Right 1202789397 9_KI270719v1_random:71097-71119 CAGGCACATGGTGTTGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202789397 Original CRISPR CAGGCACATGGTGTTGTTGG TGG Intergenic
No off target data available for this crispr