ID: 1202791095

View in Genome Browser
Species Human (GRCh38)
Location 9_KI270719v1_random:90675-90697
Sequence GAGTTGAATTTGAAGTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202791089_1202791095 1 Left 1202791089 9_KI270719v1_random:90651-90673 CCCCAACTCGGACAGAAGGCCCA No data
Right 1202791095 9_KI270719v1_random:90675-90697 GAGTTGAATTTGAAGTTTGTGGG No data
1202791086_1202791095 13 Left 1202791086 9_KI270719v1_random:90639-90661 CCACTAGGGGTACCCCAACTCGG No data
Right 1202791095 9_KI270719v1_random:90675-90697 GAGTTGAATTTGAAGTTTGTGGG No data
1202791090_1202791095 0 Left 1202791090 9_KI270719v1_random:90652-90674 CCCAACTCGGACAGAAGGCCCAT No data
Right 1202791095 9_KI270719v1_random:90675-90697 GAGTTGAATTTGAAGTTTGTGGG No data
1202791082_1202791095 30 Left 1202791082 9_KI270719v1_random:90622-90644 CCAGGGTTCGCGTCGGGCCACTA No data
Right 1202791095 9_KI270719v1_random:90675-90697 GAGTTGAATTTGAAGTTTGTGGG No data
1202791091_1202791095 -1 Left 1202791091 9_KI270719v1_random:90653-90675 CCAACTCGGACAGAAGGCCCATG No data
Right 1202791095 9_KI270719v1_random:90675-90697 GAGTTGAATTTGAAGTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202791095 Original CRISPR GAGTTGAATTTGAAGTTTGT GGG Intergenic
No off target data available for this crispr