ID: 1202793965

View in Genome Browser
Species Human (GRCh38)
Location 9_KI270719v1_random:104192-104214
Sequence AGCCCACTGGGGTCCTGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202793961_1202793965 2 Left 1202793961 9_KI270719v1_random:104167-104189 CCTATGGGGAGGATGAGCAGTCA No data
Right 1202793965 9_KI270719v1_random:104192-104214 AGCCCACTGGGGTCCTGCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202793965 Original CRISPR AGCCCACTGGGGTCCTGCGT AGG Intergenic
No off target data available for this crispr