ID: 1202795212

View in Genome Browser
Species Human (GRCh38)
Location 9_KI270719v1_random:114806-114828
Sequence CTGCGGCAGGCAGTGGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202795212_1202795225 30 Left 1202795212 9_KI270719v1_random:114806-114828 CCACTGGCCACTGCCTGCCGCAG No data
Right 1202795225 9_KI270719v1_random:114859-114881 CCCTTCTGGCACCTTTACCCAGG No data
1202795212_1202795219 3 Left 1202795212 9_KI270719v1_random:114806-114828 CCACTGGCCACTGCCTGCCGCAG No data
Right 1202795219 9_KI270719v1_random:114832-114854 TGCCTCACAGCCTCAAAGGCAGG No data
1202795212_1202795222 16 Left 1202795212 9_KI270719v1_random:114806-114828 CCACTGGCCACTGCCTGCCGCAG No data
Right 1202795222 9_KI270719v1_random:114845-114867 CAAAGGCAGGCCTGCCCTTCTGG No data
1202795212_1202795216 -1 Left 1202795212 9_KI270719v1_random:114806-114828 CCACTGGCCACTGCCTGCCGCAG No data
Right 1202795216 9_KI270719v1_random:114828-114850 GCCCTGCCTCACAGCCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202795212 Original CRISPR CTGCGGCAGGCAGTGGCCAG TGG (reversed) Intergenic
No off target data available for this crispr