ID: 1202800411

View in Genome Browser
Species Human (GRCh38)
Location 9_KI270719v1_random:170323-170345
Sequence GGGCCGTTGGTATGGGCACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202800411_1202800415 -9 Left 1202800411 9_KI270719v1_random:170323-170345 CCGAGTGCCCATACCAACGGCCC No data
Right 1202800415 9_KI270719v1_random:170337-170359 CAACGGCCCCGATCTCCCTCAGG No data
1202800411_1202800429 21 Left 1202800411 9_KI270719v1_random:170323-170345 CCGAGTGCCCATACCAACGGCCC No data
Right 1202800429 9_KI270719v1_random:170367-170389 CTGGGCGGGAGGCACAGCCTGGG No data
1202800411_1202800422 3 Left 1202800411 9_KI270719v1_random:170323-170345 CCGAGTGCCCATACCAACGGCCC No data
Right 1202800422 9_KI270719v1_random:170349-170371 TCTCCCTCAGGTGGAGGACTGGG No data
1202800411_1202800421 2 Left 1202800411 9_KI270719v1_random:170323-170345 CCGAGTGCCCATACCAACGGCCC No data
Right 1202800421 9_KI270719v1_random:170348-170370 ATCTCCCTCAGGTGGAGGACTGG No data
1202800411_1202800424 6 Left 1202800411 9_KI270719v1_random:170323-170345 CCGAGTGCCCATACCAACGGCCC No data
Right 1202800424 9_KI270719v1_random:170352-170374 CCCTCAGGTGGAGGACTGGGCGG No data
1202800411_1202800431 23 Left 1202800411 9_KI270719v1_random:170323-170345 CCGAGTGCCCATACCAACGGCCC No data
Right 1202800431 9_KI270719v1_random:170369-170391 GGGCGGGAGGCACAGCCTGGGGG No data
1202800411_1202800430 22 Left 1202800411 9_KI270719v1_random:170323-170345 CCGAGTGCCCATACCAACGGCCC No data
Right 1202800430 9_KI270719v1_random:170368-170390 TGGGCGGGAGGCACAGCCTGGGG No data
1202800411_1202800416 -6 Left 1202800411 9_KI270719v1_random:170323-170345 CCGAGTGCCCATACCAACGGCCC No data
Right 1202800416 9_KI270719v1_random:170340-170362 CGGCCCCGATCTCCCTCAGGTGG No data
1202800411_1202800427 10 Left 1202800411 9_KI270719v1_random:170323-170345 CCGAGTGCCCATACCAACGGCCC No data
Right 1202800427 9_KI270719v1_random:170356-170378 CAGGTGGAGGACTGGGCGGGAGG No data
1202800411_1202800428 20 Left 1202800411 9_KI270719v1_random:170323-170345 CCGAGTGCCCATACCAACGGCCC No data
Right 1202800428 9_KI270719v1_random:170366-170388 ACTGGGCGGGAGGCACAGCCTGG No data
1202800411_1202800418 -3 Left 1202800411 9_KI270719v1_random:170323-170345 CCGAGTGCCCATACCAACGGCCC No data
Right 1202800418 9_KI270719v1_random:170343-170365 CCCCGATCTCCCTCAGGTGGAGG No data
1202800411_1202800426 7 Left 1202800411 9_KI270719v1_random:170323-170345 CCGAGTGCCCATACCAACGGCCC No data
Right 1202800426 9_KI270719v1_random:170353-170375 CCTCAGGTGGAGGACTGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202800411 Original CRISPR GGGCCGTTGGTATGGGCACT CGG (reversed) Intergenic