ID: 1202800412

View in Genome Browser
Species Human (GRCh38)
Location 9_KI270719v1_random:170330-170352
Sequence GAGATCGGGGCCGTTGGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202800412_1202800434 29 Left 1202800412 9_KI270719v1_random:170330-170352 CCCATACCAACGGCCCCGATCTC No data
Right 1202800434 9_KI270719v1_random:170382-170404 AGCCTGGGGGCCCTCAGGCTGGG No data
1202800412_1202800430 15 Left 1202800412 9_KI270719v1_random:170330-170352 CCCATACCAACGGCCCCGATCTC No data
Right 1202800430 9_KI270719v1_random:170368-170390 TGGGCGGGAGGCACAGCCTGGGG No data
1202800412_1202800433 28 Left 1202800412 9_KI270719v1_random:170330-170352 CCCATACCAACGGCCCCGATCTC No data
Right 1202800433 9_KI270719v1_random:170381-170403 CAGCCTGGGGGCCCTCAGGCTGG No data
1202800412_1202800429 14 Left 1202800412 9_KI270719v1_random:170330-170352 CCCATACCAACGGCCCCGATCTC No data
Right 1202800429 9_KI270719v1_random:170367-170389 CTGGGCGGGAGGCACAGCCTGGG No data
1202800412_1202800426 0 Left 1202800412 9_KI270719v1_random:170330-170352 CCCATACCAACGGCCCCGATCTC No data
Right 1202800426 9_KI270719v1_random:170353-170375 CCTCAGGTGGAGGACTGGGCGGG No data
1202800412_1202800418 -10 Left 1202800412 9_KI270719v1_random:170330-170352 CCCATACCAACGGCCCCGATCTC No data
Right 1202800418 9_KI270719v1_random:170343-170365 CCCCGATCTCCCTCAGGTGGAGG No data
1202800412_1202800431 16 Left 1202800412 9_KI270719v1_random:170330-170352 CCCATACCAACGGCCCCGATCTC No data
Right 1202800431 9_KI270719v1_random:170369-170391 GGGCGGGAGGCACAGCCTGGGGG No data
1202800412_1202800424 -1 Left 1202800412 9_KI270719v1_random:170330-170352 CCCATACCAACGGCCCCGATCTC No data
Right 1202800424 9_KI270719v1_random:170352-170374 CCCTCAGGTGGAGGACTGGGCGG No data
1202800412_1202800427 3 Left 1202800412 9_KI270719v1_random:170330-170352 CCCATACCAACGGCCCCGATCTC No data
Right 1202800427 9_KI270719v1_random:170356-170378 CAGGTGGAGGACTGGGCGGGAGG No data
1202800412_1202800421 -5 Left 1202800412 9_KI270719v1_random:170330-170352 CCCATACCAACGGCCCCGATCTC No data
Right 1202800421 9_KI270719v1_random:170348-170370 ATCTCCCTCAGGTGGAGGACTGG No data
1202800412_1202800422 -4 Left 1202800412 9_KI270719v1_random:170330-170352 CCCATACCAACGGCCCCGATCTC No data
Right 1202800422 9_KI270719v1_random:170349-170371 TCTCCCTCAGGTGGAGGACTGGG No data
1202800412_1202800428 13 Left 1202800412 9_KI270719v1_random:170330-170352 CCCATACCAACGGCCCCGATCTC No data
Right 1202800428 9_KI270719v1_random:170366-170388 ACTGGGCGGGAGGCACAGCCTGG No data
1202800412_1202800432 24 Left 1202800412 9_KI270719v1_random:170330-170352 CCCATACCAACGGCCCCGATCTC No data
Right 1202800432 9_KI270719v1_random:170377-170399 GGCACAGCCTGGGGGCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202800412 Original CRISPR GAGATCGGGGCCGTTGGTAT GGG (reversed) Intergenic