ID: 1202800414

View in Genome Browser
Species Human (GRCh38)
Location 9_KI270719v1_random:170336-170358
Sequence CTGAGGGAGATCGGGGCCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202800414_1202800429 8 Left 1202800414 9_KI270719v1_random:170336-170358 CCAACGGCCCCGATCTCCCTCAG No data
Right 1202800429 9_KI270719v1_random:170367-170389 CTGGGCGGGAGGCACAGCCTGGG No data
1202800414_1202800426 -6 Left 1202800414 9_KI270719v1_random:170336-170358 CCAACGGCCCCGATCTCCCTCAG No data
Right 1202800426 9_KI270719v1_random:170353-170375 CCTCAGGTGGAGGACTGGGCGGG No data
1202800414_1202800430 9 Left 1202800414 9_KI270719v1_random:170336-170358 CCAACGGCCCCGATCTCCCTCAG No data
Right 1202800430 9_KI270719v1_random:170368-170390 TGGGCGGGAGGCACAGCCTGGGG No data
1202800414_1202800431 10 Left 1202800414 9_KI270719v1_random:170336-170358 CCAACGGCCCCGATCTCCCTCAG No data
Right 1202800431 9_KI270719v1_random:170369-170391 GGGCGGGAGGCACAGCCTGGGGG No data
1202800414_1202800434 23 Left 1202800414 9_KI270719v1_random:170336-170358 CCAACGGCCCCGATCTCCCTCAG No data
Right 1202800434 9_KI270719v1_random:170382-170404 AGCCTGGGGGCCCTCAGGCTGGG No data
1202800414_1202800432 18 Left 1202800414 9_KI270719v1_random:170336-170358 CCAACGGCCCCGATCTCCCTCAG No data
Right 1202800432 9_KI270719v1_random:170377-170399 GGCACAGCCTGGGGGCCCTCAGG No data
1202800414_1202800427 -3 Left 1202800414 9_KI270719v1_random:170336-170358 CCAACGGCCCCGATCTCCCTCAG No data
Right 1202800427 9_KI270719v1_random:170356-170378 CAGGTGGAGGACTGGGCGGGAGG No data
1202800414_1202800433 22 Left 1202800414 9_KI270719v1_random:170336-170358 CCAACGGCCCCGATCTCCCTCAG No data
Right 1202800433 9_KI270719v1_random:170381-170403 CAGCCTGGGGGCCCTCAGGCTGG No data
1202800414_1202800424 -7 Left 1202800414 9_KI270719v1_random:170336-170358 CCAACGGCCCCGATCTCCCTCAG No data
Right 1202800424 9_KI270719v1_random:170352-170374 CCCTCAGGTGGAGGACTGGGCGG No data
1202800414_1202800428 7 Left 1202800414 9_KI270719v1_random:170336-170358 CCAACGGCCCCGATCTCCCTCAG No data
Right 1202800428 9_KI270719v1_random:170366-170388 ACTGGGCGGGAGGCACAGCCTGG No data
1202800414_1202800422 -10 Left 1202800414 9_KI270719v1_random:170336-170358 CCAACGGCCCCGATCTCCCTCAG No data
Right 1202800422 9_KI270719v1_random:170349-170371 TCTCCCTCAGGTGGAGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202800414 Original CRISPR CTGAGGGAGATCGGGGCCGT TGG (reversed) Intergenic
No off target data available for this crispr