ID: 1202800419

View in Genome Browser
Species Human (GRCh38)
Location 9_KI270719v1_random:170344-170366
Sequence TCCTCCACCTGAGGGAGATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202800419_1202800430 1 Left 1202800419 9_KI270719v1_random:170344-170366 CCCGATCTCCCTCAGGTGGAGGA No data
Right 1202800430 9_KI270719v1_random:170368-170390 TGGGCGGGAGGCACAGCCTGGGG No data
1202800419_1202800433 14 Left 1202800419 9_KI270719v1_random:170344-170366 CCCGATCTCCCTCAGGTGGAGGA No data
Right 1202800433 9_KI270719v1_random:170381-170403 CAGCCTGGGGGCCCTCAGGCTGG No data
1202800419_1202800431 2 Left 1202800419 9_KI270719v1_random:170344-170366 CCCGATCTCCCTCAGGTGGAGGA No data
Right 1202800431 9_KI270719v1_random:170369-170391 GGGCGGGAGGCACAGCCTGGGGG No data
1202800419_1202800428 -1 Left 1202800419 9_KI270719v1_random:170344-170366 CCCGATCTCCCTCAGGTGGAGGA No data
Right 1202800428 9_KI270719v1_random:170366-170388 ACTGGGCGGGAGGCACAGCCTGG No data
1202800419_1202800436 23 Left 1202800419 9_KI270719v1_random:170344-170366 CCCGATCTCCCTCAGGTGGAGGA No data
Right 1202800436 9_KI270719v1_random:170390-170412 GGCCCTCAGGCTGGGCGCGCTGG No data
1202800419_1202800429 0 Left 1202800419 9_KI270719v1_random:170344-170366 CCCGATCTCCCTCAGGTGGAGGA No data
Right 1202800429 9_KI270719v1_random:170367-170389 CTGGGCGGGAGGCACAGCCTGGG No data
1202800419_1202800434 15 Left 1202800419 9_KI270719v1_random:170344-170366 CCCGATCTCCCTCAGGTGGAGGA No data
Right 1202800434 9_KI270719v1_random:170382-170404 AGCCTGGGGGCCCTCAGGCTGGG No data
1202800419_1202800432 10 Left 1202800419 9_KI270719v1_random:170344-170366 CCCGATCTCCCTCAGGTGGAGGA No data
Right 1202800432 9_KI270719v1_random:170377-170399 GGCACAGCCTGGGGGCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202800419 Original CRISPR TCCTCCACCTGAGGGAGATC GGG (reversed) Intergenic