ID: 1202800420

View in Genome Browser
Species Human (GRCh38)
Location 9_KI270719v1_random:170345-170367
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202800420_1202800433 13 Left 1202800420 9_KI270719v1_random:170345-170367 CCGATCTCCCTCAGGTGGAGGAC No data
Right 1202800433 9_KI270719v1_random:170381-170403 CAGCCTGGGGGCCCTCAGGCTGG No data
1202800420_1202800432 9 Left 1202800420 9_KI270719v1_random:170345-170367 CCGATCTCCCTCAGGTGGAGGAC No data
Right 1202800432 9_KI270719v1_random:170377-170399 GGCACAGCCTGGGGGCCCTCAGG No data
1202800420_1202800430 0 Left 1202800420 9_KI270719v1_random:170345-170367 CCGATCTCCCTCAGGTGGAGGAC No data
Right 1202800430 9_KI270719v1_random:170368-170390 TGGGCGGGAGGCACAGCCTGGGG No data
1202800420_1202800429 -1 Left 1202800420 9_KI270719v1_random:170345-170367 CCGATCTCCCTCAGGTGGAGGAC No data
Right 1202800429 9_KI270719v1_random:170367-170389 CTGGGCGGGAGGCACAGCCTGGG No data
1202800420_1202800436 22 Left 1202800420 9_KI270719v1_random:170345-170367 CCGATCTCCCTCAGGTGGAGGAC No data
Right 1202800436 9_KI270719v1_random:170390-170412 GGCCCTCAGGCTGGGCGCGCTGG No data
1202800420_1202800428 -2 Left 1202800420 9_KI270719v1_random:170345-170367 CCGATCTCCCTCAGGTGGAGGAC No data
Right 1202800428 9_KI270719v1_random:170366-170388 ACTGGGCGGGAGGCACAGCCTGG No data
1202800420_1202800431 1 Left 1202800420 9_KI270719v1_random:170345-170367 CCGATCTCCCTCAGGTGGAGGAC No data
Right 1202800431 9_KI270719v1_random:170369-170391 GGGCGGGAGGCACAGCCTGGGGG No data
1202800420_1202800434 14 Left 1202800420 9_KI270719v1_random:170345-170367 CCGATCTCCCTCAGGTGGAGGAC No data
Right 1202800434 9_KI270719v1_random:170382-170404 AGCCTGGGGGCCCTCAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202800420 Original CRISPR GTCCTCCACCTGAGGGAGAT CGG (reversed) Intergenic