ID: 1202800422

View in Genome Browser
Species Human (GRCh38)
Location 9_KI270719v1_random:170349-170371
Sequence TCTCCCTCAGGTGGAGGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202800406_1202800422 28 Left 1202800406 9_KI270719v1_random:170298-170320 CCGCTCAACCCCACACGGGTGAC No data
Right 1202800422 9_KI270719v1_random:170349-170371 TCTCCCTCAGGTGGAGGACTGGG No data
1202800407_1202800422 20 Left 1202800407 9_KI270719v1_random:170306-170328 CCCCACACGGGTGACTGCCGAGT No data
Right 1202800422 9_KI270719v1_random:170349-170371 TCTCCCTCAGGTGGAGGACTGGG No data
1202800411_1202800422 3 Left 1202800411 9_KI270719v1_random:170323-170345 CCGAGTGCCCATACCAACGGCCC No data
Right 1202800422 9_KI270719v1_random:170349-170371 TCTCCCTCAGGTGGAGGACTGGG No data
1202800414_1202800422 -10 Left 1202800414 9_KI270719v1_random:170336-170358 CCAACGGCCCCGATCTCCCTCAG No data
Right 1202800422 9_KI270719v1_random:170349-170371 TCTCCCTCAGGTGGAGGACTGGG No data
1202800413_1202800422 -5 Left 1202800413 9_KI270719v1_random:170331-170353 CCATACCAACGGCCCCGATCTCC No data
Right 1202800422 9_KI270719v1_random:170349-170371 TCTCCCTCAGGTGGAGGACTGGG No data
1202800409_1202800422 18 Left 1202800409 9_KI270719v1_random:170308-170330 CCACACGGGTGACTGCCGAGTGC No data
Right 1202800422 9_KI270719v1_random:170349-170371 TCTCCCTCAGGTGGAGGACTGGG No data
1202800412_1202800422 -4 Left 1202800412 9_KI270719v1_random:170330-170352 CCCATACCAACGGCCCCGATCTC No data
Right 1202800422 9_KI270719v1_random:170349-170371 TCTCCCTCAGGTGGAGGACTGGG No data
1202800408_1202800422 19 Left 1202800408 9_KI270719v1_random:170307-170329 CCCACACGGGTGACTGCCGAGTG No data
Right 1202800422 9_KI270719v1_random:170349-170371 TCTCCCTCAGGTGGAGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202800422 Original CRISPR TCTCCCTCAGGTGGAGGACT GGG Intergenic
No off target data available for this crispr