ID: 1202800428

View in Genome Browser
Species Human (GRCh38)
Location 9_KI270719v1_random:170366-170388
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202800411_1202800428 20 Left 1202800411 9_KI270719v1_random:170323-170345 CCGAGTGCCCATACCAACGGCCC No data
Right 1202800428 9_KI270719v1_random:170366-170388 ACTGGGCGGGAGGCACAGCCTGG No data
1202800414_1202800428 7 Left 1202800414 9_KI270719v1_random:170336-170358 CCAACGGCCCCGATCTCCCTCAG No data
Right 1202800428 9_KI270719v1_random:170366-170388 ACTGGGCGGGAGGCACAGCCTGG No data
1202800412_1202800428 13 Left 1202800412 9_KI270719v1_random:170330-170352 CCCATACCAACGGCCCCGATCTC No data
Right 1202800428 9_KI270719v1_random:170366-170388 ACTGGGCGGGAGGCACAGCCTGG No data
1202800425_1202800428 -10 Left 1202800425 9_KI270719v1_random:170353-170375 CCTCAGGTGGAGGACTGGGCGGG No data
Right 1202800428 9_KI270719v1_random:170366-170388 ACTGGGCGGGAGGCACAGCCTGG No data
1202800417_1202800428 0 Left 1202800417 9_KI270719v1_random:170343-170365 CCCCGATCTCCCTCAGGTGGAGG No data
Right 1202800428 9_KI270719v1_random:170366-170388 ACTGGGCGGGAGGCACAGCCTGG No data
1202800413_1202800428 12 Left 1202800413 9_KI270719v1_random:170331-170353 CCATACCAACGGCCCCGATCTCC No data
Right 1202800428 9_KI270719v1_random:170366-170388 ACTGGGCGGGAGGCACAGCCTGG No data
1202800420_1202800428 -2 Left 1202800420 9_KI270719v1_random:170345-170367 CCGATCTCCCTCAGGTGGAGGAC No data
Right 1202800428 9_KI270719v1_random:170366-170388 ACTGGGCGGGAGGCACAGCCTGG No data
1202800423_1202800428 -9 Left 1202800423 9_KI270719v1_random:170352-170374 CCCTCAGGTGGAGGACTGGGCGG No data
Right 1202800428 9_KI270719v1_random:170366-170388 ACTGGGCGGGAGGCACAGCCTGG No data
1202800419_1202800428 -1 Left 1202800419 9_KI270719v1_random:170344-170366 CCCGATCTCCCTCAGGTGGAGGA No data
Right 1202800428 9_KI270719v1_random:170366-170388 ACTGGGCGGGAGGCACAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202800428 Original CRISPR ACTGGGCGGGAGGCACAGCC TGG Intergenic
No off target data available for this crispr