ID: 1202800431

View in Genome Browser
Species Human (GRCh38)
Location 9_KI270719v1_random:170369-170391
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202800420_1202800431 1 Left 1202800420 9_KI270719v1_random:170345-170367 CCGATCTCCCTCAGGTGGAGGAC No data
Right 1202800431 9_KI270719v1_random:170369-170391 GGGCGGGAGGCACAGCCTGGGGG No data
1202800417_1202800431 3 Left 1202800417 9_KI270719v1_random:170343-170365 CCCCGATCTCCCTCAGGTGGAGG No data
Right 1202800431 9_KI270719v1_random:170369-170391 GGGCGGGAGGCACAGCCTGGGGG No data
1202800423_1202800431 -6 Left 1202800423 9_KI270719v1_random:170352-170374 CCCTCAGGTGGAGGACTGGGCGG No data
Right 1202800431 9_KI270719v1_random:170369-170391 GGGCGGGAGGCACAGCCTGGGGG No data
1202800425_1202800431 -7 Left 1202800425 9_KI270719v1_random:170353-170375 CCTCAGGTGGAGGACTGGGCGGG No data
Right 1202800431 9_KI270719v1_random:170369-170391 GGGCGGGAGGCACAGCCTGGGGG No data
1202800411_1202800431 23 Left 1202800411 9_KI270719v1_random:170323-170345 CCGAGTGCCCATACCAACGGCCC No data
Right 1202800431 9_KI270719v1_random:170369-170391 GGGCGGGAGGCACAGCCTGGGGG No data
1202800414_1202800431 10 Left 1202800414 9_KI270719v1_random:170336-170358 CCAACGGCCCCGATCTCCCTCAG No data
Right 1202800431 9_KI270719v1_random:170369-170391 GGGCGGGAGGCACAGCCTGGGGG No data
1202800412_1202800431 16 Left 1202800412 9_KI270719v1_random:170330-170352 CCCATACCAACGGCCCCGATCTC No data
Right 1202800431 9_KI270719v1_random:170369-170391 GGGCGGGAGGCACAGCCTGGGGG No data
1202800413_1202800431 15 Left 1202800413 9_KI270719v1_random:170331-170353 CCATACCAACGGCCCCGATCTCC No data
Right 1202800431 9_KI270719v1_random:170369-170391 GGGCGGGAGGCACAGCCTGGGGG No data
1202800419_1202800431 2 Left 1202800419 9_KI270719v1_random:170344-170366 CCCGATCTCCCTCAGGTGGAGGA No data
Right 1202800431 9_KI270719v1_random:170369-170391 GGGCGGGAGGCACAGCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202800431 Original CRISPR GGGCGGGAGGCACAGCCTGG GGG Intergenic
No off target data available for this crispr