ID: 1202802194

View in Genome Browser
Species Human (GRCh38)
Location 9_KI270720v1_random:10091-10113
Sequence AAGTCCTTCTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202802194_1202802198 18 Left 1202802194 9_KI270720v1_random:10091-10113 CCTTCACTCTTCTAGAAGGACTT No data
Right 1202802198 9_KI270720v1_random:10132-10154 TCCATGGTTTAGAATAAAAGAGG 0: 17
1: 21
2: 24
3: 47
4: 248
1202802194_1202802196 2 Left 1202802194 9_KI270720v1_random:10091-10113 CCTTCACTCTTCTAGAAGGACTT No data
Right 1202802196 9_KI270720v1_random:10116-10138 TTTGATAGGTCCTTTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202802194 Original CRISPR AAGTCCTTCTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr