ID: 1202805462

View in Genome Browser
Species Human (GRCh38)
Location 11_KI270721v1_random:3612-3634
Sequence AGGAAGAAAAGGTCTGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202805450_1202805462 21 Left 1202805450 11_KI270721v1_random:3568-3590 CCGGTGCTGCGCGTGGCCCTGAC No data
Right 1202805462 11_KI270721v1_random:3612-3634 AGGAAGAAAAGGTCTGAGTGAGG No data
1202805454_1202805462 5 Left 1202805454 11_KI270721v1_random:3584-3606 CCCTGACCTTGGGGAACACCCAG No data
Right 1202805462 11_KI270721v1_random:3612-3634 AGGAAGAAAAGGTCTGAGTGAGG No data
1202805455_1202805462 4 Left 1202805455 11_KI270721v1_random:3585-3607 CCTGACCTTGGGGAACACCCAGC No data
Right 1202805462 11_KI270721v1_random:3612-3634 AGGAAGAAAAGGTCTGAGTGAGG No data
1202805456_1202805462 -1 Left 1202805456 11_KI270721v1_random:3590-3612 CCTTGGGGAACACCCAGCACCAA No data
Right 1202805462 11_KI270721v1_random:3612-3634 AGGAAGAAAAGGTCTGAGTGAGG No data
1202805448_1202805462 28 Left 1202805448 11_KI270721v1_random:3561-3583 CCTGGGACCGGTGCTGCGCGTGG No data
Right 1202805462 11_KI270721v1_random:3612-3634 AGGAAGAAAAGGTCTGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202805462 Original CRISPR AGGAAGAAAAGGTCTGAGTG AGG Intergenic
No off target data available for this crispr