ID: 1202806529

View in Genome Browser
Species Human (GRCh38)
Location 11_KI270721v1_random:8602-8624
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202806519_1202806529 27 Left 1202806519 11_KI270721v1_random:8552-8574 CCCACGTACTTGTTAGGGCTCAG No data
Right 1202806529 11_KI270721v1_random:8602-8624 TACGTATCCTGGGGGGCTCTGGG No data
1202806520_1202806529 26 Left 1202806520 11_KI270721v1_random:8553-8575 CCACGTACTTGTTAGGGCTCAGC No data
Right 1202806529 11_KI270721v1_random:8602-8624 TACGTATCCTGGGGGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202806529 Original CRISPR TACGTATCCTGGGGGGCTCT GGG Intergenic
No off target data available for this crispr