ID: 1202807669

View in Genome Browser
Species Human (GRCh38)
Location 11_KI270721v1_random:13864-13886
Sequence GAGGCCTGTGGGAGACATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202807669_1202807677 -10 Left 1202807669 11_KI270721v1_random:13864-13886 CCCCCATGTCTCCCACAGGCCTC No data
Right 1202807677 11_KI270721v1_random:13877-13899 CACAGGCCTCCCTGCCAGGGAGG No data
1202807669_1202807680 -2 Left 1202807669 11_KI270721v1_random:13864-13886 CCCCCATGTCTCCCACAGGCCTC No data
Right 1202807680 11_KI270721v1_random:13885-13907 TCCCTGCCAGGGAGGAGAAAGGG No data
1202807669_1202807682 -1 Left 1202807669 11_KI270721v1_random:13864-13886 CCCCCATGTCTCCCACAGGCCTC No data
Right 1202807682 11_KI270721v1_random:13886-13908 CCCTGCCAGGGAGGAGAAAGGGG No data
1202807669_1202807687 5 Left 1202807669 11_KI270721v1_random:13864-13886 CCCCCATGTCTCCCACAGGCCTC No data
Right 1202807687 11_KI270721v1_random:13892-13914 CAGGGAGGAGAAAGGGGCTGGGG No data
1202807669_1202807684 3 Left 1202807669 11_KI270721v1_random:13864-13886 CCCCCATGTCTCCCACAGGCCTC No data
Right 1202807684 11_KI270721v1_random:13890-13912 GCCAGGGAGGAGAAAGGGGCTGG No data
1202807669_1202807686 4 Left 1202807669 11_KI270721v1_random:13864-13886 CCCCCATGTCTCCCACAGGCCTC No data
Right 1202807686 11_KI270721v1_random:13891-13913 CCAGGGAGGAGAAAGGGGCTGGG No data
1202807669_1202807679 -3 Left 1202807669 11_KI270721v1_random:13864-13886 CCCCCATGTCTCCCACAGGCCTC No data
Right 1202807679 11_KI270721v1_random:13884-13906 CTCCCTGCCAGGGAGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202807669 Original CRISPR GAGGCCTGTGGGAGACATGG GGG (reversed) Intergenic
No off target data available for this crispr