ID: 1202810214

View in Genome Browser
Species Human (GRCh38)
Location 11_KI270721v1_random:24300-24322
Sequence GGGGGCTCCCTCCTTTGTAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202810214_1202810225 4 Left 1202810214 11_KI270721v1_random:24300-24322 CCGCTACAAAGGAGGGAGCCCCC No data
Right 1202810225 11_KI270721v1_random:24327-24349 TCTCAGGACACGGGGGCCTCAGG No data
1202810214_1202810226 14 Left 1202810214 11_KI270721v1_random:24300-24322 CCGCTACAAAGGAGGGAGCCCCC No data
Right 1202810226 11_KI270721v1_random:24337-24359 CGGGGGCCTCAGGCTCATTCAGG No data
1202810214_1202810230 27 Left 1202810214 11_KI270721v1_random:24300-24322 CCGCTACAAAGGAGGGAGCCCCC No data
Right 1202810230 11_KI270721v1_random:24350-24372 CTCATTCAGGAGTGCTGGGCTGG No data
1202810214_1202810216 -6 Left 1202810214 11_KI270721v1_random:24300-24322 CCGCTACAAAGGAGGGAGCCCCC No data
Right 1202810216 11_KI270721v1_random:24317-24339 GCCCCCTGCCTCTCAGGACACGG No data
1202810214_1202810220 -4 Left 1202810214 11_KI270721v1_random:24300-24322 CCGCTACAAAGGAGGGAGCCCCC No data
Right 1202810220 11_KI270721v1_random:24319-24341 CCCCTGCCTCTCAGGACACGGGG No data
1202810214_1202810231 28 Left 1202810214 11_KI270721v1_random:24300-24322 CCGCTACAAAGGAGGGAGCCCCC No data
Right 1202810231 11_KI270721v1_random:24351-24373 TCATTCAGGAGTGCTGGGCTGGG No data
1202810214_1202810218 -5 Left 1202810214 11_KI270721v1_random:24300-24322 CCGCTACAAAGGAGGGAGCCCCC No data
Right 1202810218 11_KI270721v1_random:24318-24340 CCCCCTGCCTCTCAGGACACGGG No data
1202810214_1202810222 -3 Left 1202810214 11_KI270721v1_random:24300-24322 CCGCTACAAAGGAGGGAGCCCCC No data
Right 1202810222 11_KI270721v1_random:24320-24342 CCCTGCCTCTCAGGACACGGGGG No data
1202810214_1202810229 23 Left 1202810214 11_KI270721v1_random:24300-24322 CCGCTACAAAGGAGGGAGCCCCC No data
Right 1202810229 11_KI270721v1_random:24346-24368 CAGGCTCATTCAGGAGTGCTGGG No data
1202810214_1202810228 22 Left 1202810214 11_KI270721v1_random:24300-24322 CCGCTACAAAGGAGGGAGCCCCC No data
Right 1202810228 11_KI270721v1_random:24345-24367 TCAGGCTCATTCAGGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202810214 Original CRISPR GGGGGCTCCCTCCTTTGTAG CGG (reversed) Intergenic
No off target data available for this crispr