ID: 1202810788

View in Genome Browser
Species Human (GRCh38)
Location 11_KI270721v1_random:26444-26466
Sequence CTGTGTGGCTGGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202810788_1202810796 0 Left 1202810788 11_KI270721v1_random:26444-26466 CCCTCCACCTTCCAGCCACACAG No data
Right 1202810796 11_KI270721v1_random:26467-26489 AGGGCCCCCCAGTGCGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202810788 Original CRISPR CTGTGTGGCTGGAAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr