ID: 1202814015

View in Genome Browser
Species Human (GRCh38)
Location 11_KI270721v1_random:39079-39101
Sequence GGGATAGTGTCCTGGGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202814015_1202814024 -10 Left 1202814015 11_KI270721v1_random:39079-39101 CCCAGGCCCCAGGACACTATCCC No data
Right 1202814024 11_KI270721v1_random:39092-39114 ACACTATCCCCGGGGGTCCAAGG No data
1202814015_1202814028 -3 Left 1202814015 11_KI270721v1_random:39079-39101 CCCAGGCCCCAGGACACTATCCC No data
Right 1202814028 11_KI270721v1_random:39099-39121 CCCCGGGGGTCCAAGGCGGGTGG No data
1202814015_1202814032 -1 Left 1202814015 11_KI270721v1_random:39079-39101 CCCAGGCCCCAGGACACTATCCC No data
Right 1202814032 11_KI270721v1_random:39101-39123 CCGGGGGTCCAAGGCGGGTGGGG No data
1202814015_1202814026 -6 Left 1202814015 11_KI270721v1_random:39079-39101 CCCAGGCCCCAGGACACTATCCC No data
Right 1202814026 11_KI270721v1_random:39096-39118 TATCCCCGGGGGTCCAAGGCGGG No data
1202814015_1202814030 -2 Left 1202814015 11_KI270721v1_random:39079-39101 CCCAGGCCCCAGGACACTATCCC No data
Right 1202814030 11_KI270721v1_random:39100-39122 CCCGGGGGTCCAAGGCGGGTGGG No data
1202814015_1202814025 -7 Left 1202814015 11_KI270721v1_random:39079-39101 CCCAGGCCCCAGGACACTATCCC No data
Right 1202814025 11_KI270721v1_random:39095-39117 CTATCCCCGGGGGTCCAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202814015 Original CRISPR GGGATAGTGTCCTGGGGCCT GGG (reversed) Intergenic