ID: 1202816087

View in Genome Browser
Species Human (GRCh38)
Location 11_KI270721v1_random:47170-47192
Sequence AGGCAGGGATTAGGGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202816087_1202816093 -7 Left 1202816087 11_KI270721v1_random:47170-47192 CCAGCTGCCCCTAATCCCTGCCT No data
Right 1202816093 11_KI270721v1_random:47186-47208 CCTGCCTGAAAACGTGCTCCTGG No data
1202816087_1202816094 -6 Left 1202816087 11_KI270721v1_random:47170-47192 CCAGCTGCCCCTAATCCCTGCCT No data
Right 1202816094 11_KI270721v1_random:47187-47209 CTGCCTGAAAACGTGCTCCTGGG No data
1202816087_1202816096 0 Left 1202816087 11_KI270721v1_random:47170-47192 CCAGCTGCCCCTAATCCCTGCCT No data
Right 1202816096 11_KI270721v1_random:47193-47215 GAAAACGTGCTCCTGGGTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202816087 Original CRISPR AGGCAGGGATTAGGGGCAGC TGG (reversed) Intergenic
No off target data available for this crispr