ID: 1202817872

View in Genome Browser
Species Human (GRCh38)
Location 11_KI270721v1_random:54002-54024
Sequence TTCCCATGGCCCCACCGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202817862_1202817872 24 Left 1202817862 11_KI270721v1_random:53955-53977 CCCTCTGGGATGTGGAAGGGCTG No data
Right 1202817872 11_KI270721v1_random:54002-54024 TTCCCATGGCCCCACCGGAAAGG No data
1202817867_1202817872 -5 Left 1202817867 11_KI270721v1_random:53984-54006 CCTTCGGCAAACCCTCTGTTCCC No data
Right 1202817872 11_KI270721v1_random:54002-54024 TTCCCATGGCCCCACCGGAAAGG No data
1202817866_1202817872 0 Left 1202817866 11_KI270721v1_random:53979-54001 CCGCGCCTTCGGCAAACCCTCTG No data
Right 1202817872 11_KI270721v1_random:54002-54024 TTCCCATGGCCCCACCGGAAAGG No data
1202817863_1202817872 23 Left 1202817863 11_KI270721v1_random:53956-53978 CCTCTGGGATGTGGAAGGGCTGG No data
Right 1202817872 11_KI270721v1_random:54002-54024 TTCCCATGGCCCCACCGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202817872 Original CRISPR TTCCCATGGCCCCACCGGAA AGG Intergenic
No off target data available for this crispr