ID: 1202819555

View in Genome Browser
Species Human (GRCh38)
Location 11_KI270721v1_random:62813-62835
Sequence TTATTCAGTGCAGCATAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202819551_1202819555 6 Left 1202819551 11_KI270721v1_random:62784-62806 CCTGGGTGGACATGAATTTCCAG No data
Right 1202819555 11_KI270721v1_random:62813-62835 TTATTCAGTGCAGCATAAAGTGG No data
1202819547_1202819555 24 Left 1202819547 11_KI270721v1_random:62766-62788 CCGGGGACACTCACAGGTCCTGG No data
Right 1202819555 11_KI270721v1_random:62813-62835 TTATTCAGTGCAGCATAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202819555 Original CRISPR TTATTCAGTGCAGCATAAAG TGG Intergenic
No off target data available for this crispr