ID: 1202823170

View in Genome Browser
Species Human (GRCh38)
Location 11_KI270721v1_random:78160-78182
Sequence CTGGTGGTCTCGAGGACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202823160_1202823170 24 Left 1202823160 11_KI270721v1_random:78113-78135 CCTGCGGTCGGCAGTCGAGTGGT No data
Right 1202823170 11_KI270721v1_random:78160-78182 CTGGTGGTCTCGAGGACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202823170 Original CRISPR CTGGTGGTCTCGAGGACAAA TGG Intergenic
No off target data available for this crispr