ID: 1202823732

View in Genome Browser
Species Human (GRCh38)
Location 11_KI270721v1_random:80496-80518
Sequence CCGAGCACACCTGTGCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202823732_1202823742 13 Left 1202823732 11_KI270721v1_random:80496-80518 CCCTGGGGCACAGGTGTGCTCGG No data
Right 1202823742 11_KI270721v1_random:80532-80554 CTGACTGCTCCCTTTGCGCAGGG No data
1202823732_1202823741 12 Left 1202823732 11_KI270721v1_random:80496-80518 CCCTGGGGCACAGGTGTGCTCGG No data
Right 1202823741 11_KI270721v1_random:80531-80553 CCTGACTGCTCCCTTTGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202823732 Original CRISPR CCGAGCACACCTGTGCCCCA GGG (reversed) Intergenic