ID: 1202825094 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11_KI270721v1_random:85984-86006 |
| Sequence | GACGCAGGCAGGCATGGGTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1202825094_1202825101 | 17 | Left | 1202825094 | 11_KI270721v1_random:85984-86006 | CCACACCCATGCCTGCCTGCGTC | No data | ||
| Right | 1202825101 | 11_KI270721v1_random:86024-86046 | CAATAAAAGCTCATTTGCAATGG | No data | ||||
| 1202825094_1202825102 | 23 | Left | 1202825094 | 11_KI270721v1_random:85984-86006 | CCACACCCATGCCTGCCTGCGTC | No data | ||
| Right | 1202825102 | 11_KI270721v1_random:86030-86052 | AAGCTCATTTGCAATGGACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1202825094 | Original CRISPR | GACGCAGGCAGGCATGGGTG TGG (reversed) | Intergenic | ||