ID: 1202825099

View in Genome Browser
Species Human (GRCh38)
Location 11_KI270721v1_random:86006-86028
Sequence TATTGACAGCTTTTCAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202825099_1202825104 10 Left 1202825099 11_KI270721v1_random:86006-86028 CCACTCCTGAAAAGCTGTCAATA No data
Right 1202825104 11_KI270721v1_random:86039-86061 TGCAATGGACCAGGATGCCAGGG No data
1202825099_1202825107 13 Left 1202825099 11_KI270721v1_random:86006-86028 CCACTCCTGAAAAGCTGTCAATA No data
Right 1202825107 11_KI270721v1_random:86042-86064 AATGGACCAGGATGCCAGGGGGG No data
1202825099_1202825114 30 Left 1202825099 11_KI270721v1_random:86006-86028 CCACTCCTGAAAAGCTGTCAATA No data
Right 1202825114 11_KI270721v1_random:86059-86081 GGGGGGTCTCCAGGTGGGCAGGG No data
1202825099_1202825106 12 Left 1202825099 11_KI270721v1_random:86006-86028 CCACTCCTGAAAAGCTGTCAATA No data
Right 1202825106 11_KI270721v1_random:86041-86063 CAATGGACCAGGATGCCAGGGGG No data
1202825099_1202825101 -5 Left 1202825099 11_KI270721v1_random:86006-86028 CCACTCCTGAAAAGCTGTCAATA No data
Right 1202825101 11_KI270721v1_random:86024-86046 CAATAAAAGCTCATTTGCAATGG No data
1202825099_1202825110 24 Left 1202825099 11_KI270721v1_random:86006-86028 CCACTCCTGAAAAGCTGTCAATA No data
Right 1202825110 11_KI270721v1_random:86053-86075 ATGCCAGGGGGGTCTCCAGGTGG No data
1202825099_1202825105 11 Left 1202825099 11_KI270721v1_random:86006-86028 CCACTCCTGAAAAGCTGTCAATA No data
Right 1202825105 11_KI270721v1_random:86040-86062 GCAATGGACCAGGATGCCAGGGG No data
1202825099_1202825111 25 Left 1202825099 11_KI270721v1_random:86006-86028 CCACTCCTGAAAAGCTGTCAATA No data
Right 1202825111 11_KI270721v1_random:86054-86076 TGCCAGGGGGGTCTCCAGGTGGG No data
1202825099_1202825103 9 Left 1202825099 11_KI270721v1_random:86006-86028 CCACTCCTGAAAAGCTGTCAATA No data
Right 1202825103 11_KI270721v1_random:86038-86060 TTGCAATGGACCAGGATGCCAGG No data
1202825099_1202825102 1 Left 1202825099 11_KI270721v1_random:86006-86028 CCACTCCTGAAAAGCTGTCAATA No data
Right 1202825102 11_KI270721v1_random:86030-86052 AAGCTCATTTGCAATGGACCAGG No data
1202825099_1202825109 21 Left 1202825099 11_KI270721v1_random:86006-86028 CCACTCCTGAAAAGCTGTCAATA No data
Right 1202825109 11_KI270721v1_random:86050-86072 AGGATGCCAGGGGGGTCTCCAGG No data
1202825099_1202825113 29 Left 1202825099 11_KI270721v1_random:86006-86028 CCACTCCTGAAAAGCTGTCAATA No data
Right 1202825113 11_KI270721v1_random:86058-86080 AGGGGGGTCTCCAGGTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202825099 Original CRISPR TATTGACAGCTTTTCAGGAG TGG (reversed) Intergenic