ID: 1202825106

View in Genome Browser
Species Human (GRCh38)
Location 11_KI270721v1_random:86041-86063
Sequence CAATGGACCAGGATGCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202825097_1202825106 23 Left 1202825097 11_KI270721v1_random:85995-86017 CCTGCCTGCGTCCACTCCTGAAA No data
Right 1202825106 11_KI270721v1_random:86041-86063 CAATGGACCAGGATGCCAGGGGG No data
1202825100_1202825106 7 Left 1202825100 11_KI270721v1_random:86011-86033 CCTGAAAAGCTGTCAATAAAAGC No data
Right 1202825106 11_KI270721v1_random:86041-86063 CAATGGACCAGGATGCCAGGGGG No data
1202825099_1202825106 12 Left 1202825099 11_KI270721v1_random:86006-86028 CCACTCCTGAAAAGCTGTCAATA No data
Right 1202825106 11_KI270721v1_random:86041-86063 CAATGGACCAGGATGCCAGGGGG No data
1202825098_1202825106 19 Left 1202825098 11_KI270721v1_random:85999-86021 CCTGCGTCCACTCCTGAAAAGCT No data
Right 1202825106 11_KI270721v1_random:86041-86063 CAATGGACCAGGATGCCAGGGGG No data
1202825095_1202825106 29 Left 1202825095 11_KI270721v1_random:85989-86011 CCCATGCCTGCCTGCGTCCACTC No data
Right 1202825106 11_KI270721v1_random:86041-86063 CAATGGACCAGGATGCCAGGGGG No data
1202825096_1202825106 28 Left 1202825096 11_KI270721v1_random:85990-86012 CCATGCCTGCCTGCGTCCACTCC No data
Right 1202825106 11_KI270721v1_random:86041-86063 CAATGGACCAGGATGCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202825106 Original CRISPR CAATGGACCAGGATGCCAGG GGG Intergenic