ID: 1202825109 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11_KI270721v1_random:86050-86072 |
| Sequence | AGGATGCCAGGGGGGTCTCC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1202825098_1202825109 | 28 | Left | 1202825098 | 11_KI270721v1_random:85999-86021 | CCTGCGTCCACTCCTGAAAAGCT | No data | ||
| Right | 1202825109 | 11_KI270721v1_random:86050-86072 | AGGATGCCAGGGGGGTCTCCAGG | No data | ||||
| 1202825100_1202825109 | 16 | Left | 1202825100 | 11_KI270721v1_random:86011-86033 | CCTGAAAAGCTGTCAATAAAAGC | No data | ||
| Right | 1202825109 | 11_KI270721v1_random:86050-86072 | AGGATGCCAGGGGGGTCTCCAGG | No data | ||||
| 1202825099_1202825109 | 21 | Left | 1202825099 | 11_KI270721v1_random:86006-86028 | CCACTCCTGAAAAGCTGTCAATA | No data | ||
| Right | 1202825109 | 11_KI270721v1_random:86050-86072 | AGGATGCCAGGGGGGTCTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1202825109 | Original CRISPR | AGGATGCCAGGGGGGTCTCC AGG | Intergenic | ||