ID: 1202825110

View in Genome Browser
Species Human (GRCh38)
Location 11_KI270721v1_random:86053-86075
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202825100_1202825110 19 Left 1202825100 11_KI270721v1_random:86011-86033 CCTGAAAAGCTGTCAATAAAAGC No data
Right 1202825110 11_KI270721v1_random:86053-86075 ATGCCAGGGGGGTCTCCAGGTGG No data
1202825099_1202825110 24 Left 1202825099 11_KI270721v1_random:86006-86028 CCACTCCTGAAAAGCTGTCAATA No data
Right 1202825110 11_KI270721v1_random:86053-86075 ATGCCAGGGGGGTCTCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202825110 Original CRISPR ATGCCAGGGGGGTCTCCAGG TGG Intergenic
No off target data available for this crispr