ID: 1202825116 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11_KI270721v1_random:86061-86083 |
Sequence | GGGGTCTCCAGGTGGGCAGG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1202825108_1202825116 | -10 | Left | 1202825108 | 11_KI270721v1_random:86048-86070 | CCAGGATGCCAGGGGGGTCTCCA | No data | ||
Right | 1202825116 | 11_KI270721v1_random:86061-86083 | GGGGTCTCCAGGTGGGCAGGGGG | No data | ||||
1202825100_1202825116 | 27 | Left | 1202825100 | 11_KI270721v1_random:86011-86033 | CCTGAAAAGCTGTCAATAAAAGC | No data | ||
Right | 1202825116 | 11_KI270721v1_random:86061-86083 | GGGGTCTCCAGGTGGGCAGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1202825116 | Original CRISPR | GGGGTCTCCAGGTGGGCAGG GGG | Intergenic | ||