ID: 1202826591

View in Genome Browser
Species Human (GRCh38)
Location 11_KI270721v1_random:91890-91912
Sequence CCCAGACTTGGGGCTTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202826586_1202826591 0 Left 1202826586 11_KI270721v1_random:91867-91889 CCAGGCTGGGAGCTCAGCACAAG No data
Right 1202826591 11_KI270721v1_random:91890-91912 CCCAGACTTGGGGCTTCCTTTGG No data
1202826585_1202826591 9 Left 1202826585 11_KI270721v1_random:91858-91880 CCTCTGTGACCAGGCTGGGAGCT No data
Right 1202826591 11_KI270721v1_random:91890-91912 CCCAGACTTGGGGCTTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202826591 Original CRISPR CCCAGACTTGGGGCTTCCTT TGG Intergenic
No off target data available for this crispr